Skip to main content

Advertisement

Table 1 Example of each GPRO mention type

From: Statistical principle-based approach for gene and protein related object recognition

Original mention type Simplified mention type Example
Abbreviation Type 1 “TNF” and “LFA-3”
Full name Type 1 “Cholesteryl ester transfer protein”
Identifier Type 1 “EC 3.4.14.5”
Nested mentions Type 1 “neurokinin-1 (NK-1) receptor”
Family Type 2 “heparan sulfate binding proteins”
Multiple Type 2 “melanocortin 1 and/or 4 receptors”
No class Type 2 “SH2 domain”
Sequence Type 2 “ACACCUGGUGACUAGUGGUGCG”